ID: 1092799883_1092799887

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1092799883 1092799887
Species Human (GRCh38) Human (GRCh38)
Location 12:12153963-12153985 12:12154006-12154028
Sequence CCAGGGGCATTGAGTAGGAACTG TAGCCACGCCATACACCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 158} {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!