ID: 1092829413_1092829422

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1092829413 1092829422
Species Human (GRCh38) Human (GRCh38)
Location 12:12429398-12429420 12:12429440-12429462
Sequence CCCATCTTCTTATTTTCTCTGTC ACCCGGGGCAGGATTTGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 866} {0: 1, 1: 0, 2: 0, 3: 12, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!