ID: 1092829557_1092829561

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1092829557 1092829561
Species Human (GRCh38) Human (GRCh38)
Location 12:12430477-12430499 12:12430507-12430529
Sequence CCATATGAACTTTGGTGAGAATT AGGTTTTTACTTATGGAGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 250} {0: 1, 1: 0, 2: 6, 3: 16, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!