ID: 1092839723_1092839737

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1092839723 1092839737
Species Human (GRCh38) Human (GRCh38)
Location 12:12528251-12528273 12:12528303-12528325
Sequence CCCCTCTACACTTAATGCTTCCT CTACCTACTGGGAGAGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 458} {0: 1, 1: 0, 2: 1, 3: 22, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!