ID: 1092865028_1092865038

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1092865028 1092865038
Species Human (GRCh38) Human (GRCh38)
Location 12:12752886-12752908 12:12752938-12752960
Sequence CCCTTCTCTATCTGTTTAGCCAG CTCAAGAAAAATGGGTAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 264} {0: 1, 1: 0, 2: 1, 3: 35, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!