ID: 1092865709_1092865712

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1092865709 1092865712
Species Human (GRCh38) Human (GRCh38)
Location 12:12759034-12759056 12:12759060-12759082
Sequence CCTACAGTGTGGTTCAGCTGGAC AGGAGGACTCACATCCTGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 122} {0: 1, 1: 0, 2: 1, 3: 24, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!