ID: 1092871552_1092871555

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1092871552 1092871555
Species Human (GRCh38) Human (GRCh38)
Location 12:12810274-12810296 12:12810298-12810320
Sequence CCTTGTCTCTTAGATTGTTGGGG CCAGCCTCAACACCACCCGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 94} {0: 16, 1: 26, 2: 13, 3: 12, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!