ID: 1092871552_1092871565

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1092871552 1092871565
Species Human (GRCh38) Human (GRCh38)
Location 12:12810274-12810296 12:12810325-12810347
Sequence CCTTGTCTCTTAGATTGTTGGGG CCAAAGTCCGGTGGCAACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 94} {0: 2, 1: 4, 2: 13, 3: 21, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!