ID: 1092899359_1092899369

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1092899359 1092899369
Species Human (GRCh38) Human (GRCh38)
Location 12:13044330-13044352 12:13044371-13044393
Sequence CCCCACGCACCGCCGCTCGGAAC GCGGGCGCGCGCACGCGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45} {0: 1, 1: 0, 2: 2, 3: 30, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!