ID: 1092927689_1092927697

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1092927689 1092927697
Species Human (GRCh38) Human (GRCh38)
Location 12:13287113-13287135 12:13287126-13287148
Sequence CCCCCATAAAAACCCTGGACACC CCTGGACACCAAAGCTCGGGTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 54, 3: 156, 4: 402} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!