ID: 1092954478_1092954481

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1092954478 1092954481
Species Human (GRCh38) Human (GRCh38)
Location 12:13537116-13537138 12:13537136-13537158
Sequence CCAGGCAAAGAACATCAATGTGG TGGATAGGTTTCCCTAACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 150} {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!