ID: 1092954795_1092954796

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1092954795 1092954796
Species Human (GRCh38) Human (GRCh38)
Location 12:13539992-13540014 12:13540009-13540031
Sequence CCATATAATTATGGGATTTGTTT TTGTTTCAGAATAATACATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 448} {0: 1, 1: 0, 2: 2, 3: 39, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!