ID: 1092961519_1092961527

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1092961519 1092961527
Species Human (GRCh38) Human (GRCh38)
Location 12:13600981-13601003 12:13601030-13601052
Sequence CCAGGCAAAGGAGAGGGGAACTG CACTTTGAAAGGATGGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 308} {0: 1, 1: 0, 2: 1, 3: 43, 4: 501}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!