ID: 1092972187_1092972196

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1092972187 1092972196
Species Human (GRCh38) Human (GRCh38)
Location 12:13706930-13706952 12:13706970-13706992
Sequence CCCCATCTATTATCCCTTGTAAA TTGGCTATAGAGAGGCAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172} {0: 1, 1: 0, 2: 0, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!