ID: 1092980374_1092980381

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1092980374 1092980381
Species Human (GRCh38) Human (GRCh38)
Location 12:13788729-13788751 12:13788774-13788796
Sequence CCAAAATGATTGTTTTGCTGAGG AGCATCTCCCTTTGAACTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 262} {0: 1, 1: 0, 2: 1, 3: 13, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!