ID: 1092980964_1092980966

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1092980964 1092980966
Species Human (GRCh38) Human (GRCh38)
Location 12:13793791-13793813 12:13793823-13793845
Sequence CCTCTGAGCACAATCAGTAAGTC AAATCAGACTTTTTGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101} {0: 1, 1: 1, 2: 2, 3: 45, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!