ID: 1092995686_1092995692

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1092995686 1092995692
Species Human (GRCh38) Human (GRCh38)
Location 12:13948287-13948309 12:13948303-13948325
Sequence CCCTGCCCCATATGTTTAAATGC TAAATGCTAAATTCAAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 158} {0: 1, 1: 0, 2: 4, 3: 79, 4: 668}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!