ID: 1093056772_1093056774

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1093056772 1093056774
Species Human (GRCh38) Human (GRCh38)
Location 12:14563881-14563903 12:14563915-14563937
Sequence CCGTGTAAAGAATGAACATACTG GGCCTTATGTCGAATGAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 254} {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!