|
Left Crispr |
Right Crispr |
| Crispr ID |
1093084579 |
1093084587 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:14852466-14852488
|
12:14852497-14852519
|
| Sequence |
CCCTCCTCCTCCTCCTTCTTCTT |
AGGGTCTTGCTTTGTCACCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837} |
{0: 389, 1: 6160, 2: 26529, 3: 75963, 4: 139529} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|