ID: 1093084579_1093084587

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1093084579 1093084587
Species Human (GRCh38) Human (GRCh38)
Location 12:14852466-14852488 12:14852497-14852519
Sequence CCCTCCTCCTCCTCCTTCTTCTT AGGGTCTTGCTTTGTCACCCAGG
Strand - +
Off-target summary {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837} {0: 389, 1: 6160, 2: 26529, 3: 75963, 4: 139529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!