ID: 1093092456_1093092460

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1093092456 1093092460
Species Human (GRCh38) Human (GRCh38)
Location 12:14936989-14937011 12:14937005-14937027
Sequence CCTCTCTTATTCTGCTCCTTCAG CCTTCAGATGGAATTGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 315} {0: 1, 1: 0, 2: 1, 3: 12, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!