ID: 1093094284_1093094289

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1093094284 1093094289
Species Human (GRCh38) Human (GRCh38)
Location 12:14954597-14954619 12:14954613-14954635
Sequence CCACTGCGGATCTGAGTTTCCTC TTTCCTCATCTTGGGGGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 406} {0: 1, 1: 0, 2: 2, 3: 21, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!