ID: 1093176205_1093176208

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1093176205 1093176208
Species Human (GRCh38) Human (GRCh38)
Location 12:15916108-15916130 12:15916135-15916157
Sequence CCATTGCAGTTTGTTTCAGAGAA CAATTTATCCTGAGGGAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 238} {0: 1, 1: 0, 2: 1, 3: 23, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!