ID: 1093181921_1093181931

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1093181921 1093181931
Species Human (GRCh38) Human (GRCh38)
Location 12:15976451-15976473 12:15976496-15976518
Sequence CCAAGAATTTCTCTAGGCCCCAG TCCACCTTCTTGGCAGTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200} {0: 1, 1: 0, 2: 2, 3: 27, 4: 742}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!