ID: 1093184361_1093184366

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1093184361 1093184366
Species Human (GRCh38) Human (GRCh38)
Location 12:16002991-16003013 12:16003028-16003050
Sequence CCCTTATCACCACAAACTGGGTG AATTTATCTGAGAGTTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 119} {0: 1, 1: 1, 2: 6, 3: 53, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!