ID: 1093185058_1093185066

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1093185058 1093185066
Species Human (GRCh38) Human (GRCh38)
Location 12:16010448-16010470 12:16010500-16010522
Sequence CCCATAGATGAGGTTTTCCGAGT CTGCTTTTGTTGAGGAATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52} {0: 1, 1: 0, 2: 0, 3: 26, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!