ID: 1093205664_1093205667

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1093205664 1093205667
Species Human (GRCh38) Human (GRCh38)
Location 12:16245974-16245996 12:16245987-16246009
Sequence CCATTATGTCAGCCTTTGATTAA CTTTGATTAATTGAGGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197} {0: 1, 1: 0, 2: 1, 3: 16, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!