ID: 1093234801_1093234806

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1093234801 1093234806
Species Human (GRCh38) Human (GRCh38)
Location 12:16594643-16594665 12:16594664-16594686
Sequence CCCCACAGTGTAATGAAGGGAAA AATACAACGGTCATTTAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 221} {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!