ID: 1093268286_1093268295

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1093268286 1093268295
Species Human (GRCh38) Human (GRCh38)
Location 12:17026834-17026856 12:17026883-17026905
Sequence CCTGAGGTCATAGGTGGATCTTT GGGGATTGATCTCCCAAGGGAGG
Strand - +
Off-target summary {0: 158, 1: 377, 2: 219, 3: 116, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!