ID: 1093295434_1093295447

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1093295434 1093295447
Species Human (GRCh38) Human (GRCh38)
Location 12:17384092-17384114 12:17384132-17384154
Sequence CCTCCAGTATTGGCATAGGTCTC ACCTTCATCACTGTGACCAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 7, 4: 65} {0: 6, 1: 3, 2: 2, 3: 11, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!