ID: 1093332347_1093332351

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1093332347 1093332351
Species Human (GRCh38) Human (GRCh38)
Location 12:17858250-17858272 12:17858287-17858309
Sequence CCCACTCAAAGCCGCTGAACTAC ACCTGCTCCTGAATGACTACTGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 23, 3: 40, 4: 116} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!