ID: 1093351638_1093351639

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1093351638 1093351639
Species Human (GRCh38) Human (GRCh38)
Location 12:18109586-18109608 12:18109599-18109621
Sequence CCAGTTTTAGACATGTTAAATTT TGTTAAATTTAAGTTACTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 62, 4: 491} {0: 1, 1: 0, 2: 3, 3: 28, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!