ID: 1093353607_1093353615

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1093353607 1093353615
Species Human (GRCh38) Human (GRCh38)
Location 12:18135028-18135050 12:18135080-18135102
Sequence CCTTCCAGTTTGTTCCATTCTAG GGTCTGAGGAGACAACAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 232} {0: 1, 1: 0, 2: 3, 3: 19, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!