ID: 1093381535_1093381542

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1093381535 1093381542
Species Human (GRCh38) Human (GRCh38)
Location 12:18500177-18500199 12:18500195-18500217
Sequence CCAGTGCTTGCCGGCCGGCTGGA CTGGAGTTCCAGGTGGGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 90} {0: 51, 1: 495, 2: 390, 3: 482, 4: 672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!