ID: 1093435317_1093435326

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1093435317 1093435326
Species Human (GRCh38) Human (GRCh38)
Location 12:19129657-19129679 12:19129675-19129697
Sequence CCCGAGGGGGTAGGGCGCGCGCG GCGCGGGGGCGCGCCGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 88} {0: 1, 1: 1, 2: 11, 3: 143, 4: 959}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!