ID: 1093439216_1093439222

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1093439216 1093439222
Species Human (GRCh38) Human (GRCh38)
Location 12:19173606-19173628 12:19173658-19173680
Sequence CCTCAAAGATTCTCAAATCACTC TCCCTTTGGCTCCAGGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 266} {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!