|
Left Crispr |
Right Crispr |
Crispr ID |
1093461101 |
1093461105 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:19407596-19407618
|
12:19407609-19407631
|
Sequence |
CCAGCCTCCATCTCTTTTTTCTT |
CTTTTTTCTTTTTAGAGACAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 1, 2: 35, 3: 451, 4: 3129} |
{0: 14, 1: 216, 2: 3096, 3: 26653, 4: 47383} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|