|
Left Crispr |
Right Crispr |
| Crispr ID |
1093461101 |
1093461110 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:19407596-19407618
|
12:19407646-19407668
|
| Sequence |
CCAGCCTCCATCTCTTTTTTCTT |
CCAGGCTGGTCCTGAACTCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 35, 3: 451, 4: 3129} |
{0: 411, 1: 18604, 2: 39084, 3: 58525, 4: 52639} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|