ID: 1093461101_1093461111

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1093461101 1093461111
Species Human (GRCh38) Human (GRCh38)
Location 12:19407596-19407618 12:19407647-19407669
Sequence CCAGCCTCCATCTCTTTTTTCTT CAGGCTGGTCCTGAACTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 35, 3: 451, 4: 3129} {0: 236, 1: 9507, 2: 19315, 3: 30000, 4: 28132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!