ID: 1093466641_1093466643

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1093466641 1093466643
Species Human (GRCh38) Human (GRCh38)
Location 12:19456328-19456350 12:19456357-19456379
Sequence CCACTGCAACTGTCTGTCTCATA ACAGCAGCGCGACCCAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 14, 3: 29, 4: 238} {0: 1, 1: 0, 2: 1, 3: 16, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!