ID: 1093534688_1093534701

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1093534688 1093534701
Species Human (GRCh38) Human (GRCh38)
Location 12:20209643-20209665 12:20209691-20209713
Sequence CCTTGCTTCATGGGTATATACTG GATGAGGGGTGGAAAGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 25, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!