ID: 1093566206_1093566213

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1093566206 1093566213
Species Human (GRCh38) Human (GRCh38)
Location 12:20607068-20607090 12:20607110-20607132
Sequence CCAGGATTAGGTAGGACATCCTG GATGAAGATAAAAGAGGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 72} {0: 1, 1: 0, 2: 15, 3: 101, 4: 1206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!