|
Left Crispr |
Right Crispr |
| Crispr ID |
1093570855 |
1093570859 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:20664133-20664155
|
12:20664151-20664173
|
| Sequence |
CCACCATGATTATGTTTCCTGAG |
CTGAGGCCTCCCCAGCCCTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 53, 2: 66, 3: 52, 4: 291} |
{0: 179, 1: 2147, 2: 5821, 3: 6733, 4: 5781} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|