ID: 1093607236_1093607244

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1093607236 1093607244
Species Human (GRCh38) Human (GRCh38)
Location 12:21107421-21107443 12:21107450-21107472
Sequence CCTATTAGATGGGACCTAGCAAG TGTATATCAGGTAAGAAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52} {0: 1, 1: 0, 2: 2, 3: 27, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!