ID: 1093633496_1093633497

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1093633496 1093633497
Species Human (GRCh38) Human (GRCh38)
Location 12:21437723-21437745 12:21437736-21437758
Sequence CCGGCAGCATGGAGGCAGCGCGC GGCAGCGCGCCCTCCCCCGACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 131} {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!