|
Left Crispr |
Right Crispr |
| Crispr ID |
1093639778 |
1093639784 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:21512892-21512914
|
12:21512905-21512927
|
| Sequence |
CCATCTCTACCCCCGCAAATACA |
CGCAAATACAAAAATTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 5, 3: 28, 4: 197} |
{0: 1, 1: 123, 2: 7843, 3: 84992, 4: 152152} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|