|
Left Crispr |
Right Crispr |
| Crispr ID |
1093639879 |
1093639886 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:21513754-21513776
|
12:21513803-21513825
|
| Sequence |
CCGCCACACTATAGCCTGGGCAA |
AAAGAAAAAAGAGAAAGGAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 66, 2: 1200, 3: 12400, 4: 98812} |
{0: 3, 1: 30, 2: 454, 3: 3850, 4: 18659} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|