|
Left Crispr |
Right Crispr |
Crispr ID |
1093646162 |
1093646164 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:21587604-21587626
|
12:21587638-21587660
|
Sequence |
CCTGTGGAACTGTGAGACAATTA |
CTTATAAATTACCCAGTCTCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 14, 1: 836, 2: 1379, 3: 3045, 4: 4582} |
{0: 412, 1: 7381, 2: 13906, 3: 14307, 4: 10797} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|