ID: 1093662139_1093662142

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1093662139 1093662142
Species Human (GRCh38) Human (GRCh38)
Location 12:21769223-21769245 12:21769257-21769279
Sequence CCCAAAGTATTATGCTAAATTGA CTCTATAAGTAGAACTATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 68, 4: 682} {0: 1, 1: 0, 2: 2, 3: 12, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!