ID: 1093670042_1093670045

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1093670042 1093670045
Species Human (GRCh38) Human (GRCh38)
Location 12:21862756-21862778 12:21862795-21862817
Sequence CCAAGATGGGCTGGAACTTCCAG AGAATTGATTCAAAAGACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 423} {0: 1, 1: 0, 2: 2, 3: 23, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!