ID: 1093724911_1093724912

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1093724911 1093724912
Species Human (GRCh38) Human (GRCh38)
Location 12:22493537-22493559 12:22493556-22493578
Sequence CCTATCTGTATTTGCTTTATTAC TTACTTTAACAGATATCTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 625} {0: 1, 1: 0, 2: 4, 3: 30, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!